METABLE2 Genes

PROKKA_00092 Pseudomonas

GenomePseudomonas ctg_1:94621-95121
ProductCDS phosphate-starvation-inducible protein PsiE
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK02833
Sequence
>PROKKA_00092 phosphate-starvation-inducible protein PsiE
GTGAAAATAAATTGGGCCGAGAAACTGCGGCGTAACGTGCATCAACTGGCCGAGTCCCTG
GGCAACCTGTTCGTCGAAACCTTTCACTATCTGGCGCTGTTCGCCATCGGTGCGGTGACA
GCGTGGGCGGCGGTGATGGAGTTTCTCGGGATGCTCGAAGTCGGGCACATCAAGATCGAT
GACATTCTGTTGCTGTTCATCTATCTGGAACTGGGCGCGATGGTCGGGATTTATTTCAAG
ACCAACCACATGCCGGTGCGCTTCCTGATCTACGTGGCGATCACTGCACTGACGCGCCTG
CTGATCTCCAACGTCTCGCACCACAACCCGCCGGACATGGGCATTATCTACCTGTGCGGC
GGCATTCTGCTGCTGGCGTTTGCGATCCTGGTGGTGCGTTACGCTTCGTCGCAATTCCCC
TCAGTGAAGATCGAGAACCCGCAGCGCAAGCTCGGCACGGGCTCCAGCGAACATCCTGAA
GTGGAGAAGGGCGAGCTTTAA