METABLE2 Genes

PROKKA_00093 Pseudomonas

GenomePseudomonas ctg_1:95118-95435
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00093 hypothetical protein
ATGGACAACCCATTTCAAATCATTACCGATGCATTCGCGCCGGACTATCAGATCAATCTG
AGCATTCAGGGCCTGGACGGCAGCATCATGCTGACCCTGTCCAACGCCGGCCGCATTGTG
GCCAAGCGCATGATCAGCGCCGAACAGCGCAACGATCCCGAGCGTTTGAAGAGGCTGGTG
CAAAGCATCCGGTTCGGCATCGCCATCGAACAGGGCCACAGCGCCATGTCGATCCTCGAA
GCCATGACCAGCGGCGCCGGGCTGACCCCGCCACCGCCACGGGTCAAAGGCCAGCCGGGT
CAGGCGGCGGGCCTTTAA