METABLE2 Genes

PROKKA_00096 Pseudomonas

GenomePseudomonas ctg_1:98359-98766
ProductCDS Sigma 54 modulation protein / S30EA ribosomal protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF02482.13
Sequence
>PROKKA_00096 Sigma 54 modulation protein / S30EA ribosomal protein
ATGCAAATCCAAGTCAACAGCGATAACCATATTCAAAGCAGTAAGCGACTGGAGGAGTGG
GTACGTACAACTATTGAGAGCACGCTCGACCGTTATGAAGAAGACCTGACCCGTGTCGAA
GTCCATCTGAGCGACGAGAACGGCGAAAAACCAGGTCCCCATGACTTGCGCTGCCAACTG
GAAGCGCGGCCAAAAGGCCACCAACCGATTTCCGTGACCCATAAAGCCGATTCGCTGGAA
CAGGCGATCGACGGTGCTGCCGAGAAACTCGAGCACAAACTGGATCATCTGTTCGGCAAA
CTGCGAGGTAAACCACGCGCCGCTGTAGTGCCATTTACCGGCAAAGCCAACGACAAGCTC
TTGGCGGAAGAATTTGACGAGAACGAACAGGCAGCGATCAACAGTTGA