METABLE2 Genes

PROKKA_00100 Pseudomonas

GenomePseudomonas ctg_1:102973-103278
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00100 hypothetical protein
ATGAAAGGCAAACTCGCCACCCTTCCCATGTCCTATCGTCTGGCCGTCACTTCGCGGGTA
TTGGCGGCGATTTTCGGCGGCTATCTGGTCGCGGCGCTGGCCAGCGTCACCCTGACGTTG
TGGCTGCCGCTGAACCGCGCCGAAGCCGTGGTCACCGGCATGACCGTGTCCTTTCTGGTC
TATCTGGTTGCCGTGCTCTGGTGTTTTGCCTGCCGCAGCGCGTGGTCGGCGTGGGTCGGC
CTGTTGGTGCCGAGCGTGATTCTCGCCACCGTTTCCGGTGCCGCGCGCGGTCTGGGGCTG
GCATGA