METABLE2 Genes

PROKKA_00002 Brevundimonas

GenomeBrevundimonas ctg_1:3267-3461
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00002 hypothetical protein
ATGGCGACGGCGCAACCTCAATCGGCCTGCGAAACGGATCGCCAGGCGCATATTGAAGCG
GCGGCCTTTCCGACGCGGGAATATATCGGCGCCATGGCGCTGGAAATGGCGCGGCTGGCG
CGGGACGAGGGCGACGTGCGGCTGGCTGGCTTGCCGGAACAGGCCGCGGGCGTTGCGGGT
CATCCGCAGGCCTAG