METABLE2 Genes

PROKKA_00003 Brevundimonas

GenomeBrevundimonas ctg_1:3458-4531
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK10736
Sequence
>PROKKA_00003 hypothetical protein
GTGAGCCTGGACCCGGCGGAACGCTTCGCCCGGCTGCGGCTCGCCCGCACCGACCGCATC
GGCCCCGTCGCCTTCGCTCAACTGATCGGCCGCTACGGCTCGGCCCTCAGTGCGCTGGAC
GCCCTGCCCGATCTGGTGCGCAAATCCGGCTCCGCCTCCGTTCCGCCCCCCGTAGAGACG
GTCGAACGCGAGATCGCCGCCGGCGAGGCCATCGGCGCCCGCCTGCTGGTGCTGGGCGAT
CCCGACTATCCCGAGATGCTGGCCGCGCTCGATCCGCCGCCGCCGATCCTGTGGACGCGC
GGCCGCGTCGATCTGCTGAACCAGCCCTCGGTCGCCGTCGTCGGCGCCCGCATCGCCTCG
GCGGGCGGTCAGCGGATCGCACGCGGTTTGGCGCAGCAACTCGGTCAGGCCGGTCATGTC
GTCGTCTCGGGCATGGCGCGCGGTATCGACGCCGCCGCCCACGAAGGCGCCCTGGCGACC
GGGACTGTCGCGGTCCTGGGCGGTGGAGTGAACGACATCTATCCGTCAGAACACGCCGAC
CTCTACGCCCGCCTGACCGAACAAGGCTGCGTCGTGTCCGAAAGCCCGGTCGGCGCTCGC
GCCCAGGCGCGCGACTTCCCACGCCGCAACCGCATCATCTCGGGCCTGTCGCGCGGCGTC
GTGGTGGTGGAGGCTGAGGTCCGGTCCGGTTCCCTGATCACCGCCCGTCTCGCCGCCGAA
CAGGGCCGCGATGTGTTCGCCGTACCCGGATCGCCTCTGGATCCCCGCGCGCGCGGTCCG
AACGAACTGCTGCGTCAGGGCGCCATCCTGTGCGAGGGGATCGAAGACATCGACCGCGCC
TTCAACACCCTGCGCACCCTGCGCGAGCCGCCTGCCGATCCGATGCGATTCGACGGCGAC
ATCGACGACGCCTTCCTCGACCGCGTCGCCGCCCTGTTGTCGCCAACCCCGACGCCGCGC
GACGAGATCGCCCGCGCCCTGAACGCCCCGGTGTCCCAGGTCGCCGCCGCTCTGCTGGAG
CTCAGCCTAACCGGCCGCGCCGATCTGCTGCCCGGAGGTCTCGCTTCGCTCTAG