METABLE2 Genes

PROKKA_00008 Brevundimonas

GenomeBrevundimonas ctg_1:8530-9453
ProductCDS Membrane transport protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF03547.12
Sequence
>PROKKA_00008 Membrane transport protein
TTGACGGCCCTGATCGCCGGCGTCCTGCCGGTCTTTCTGATGATCGCCCTGGGCTACGGC
TTGCGAAAGTCCGGCTTCCTGCCTGACGAGGCCTGGCGGCCGATCGAGAAGCTGTCGATC
AATATCTTCTATCCCAGCTTCCTGATCCCCGCGATCTGGCACGCCGACCTCGCCGGCGGC
GGCGCGACCGTGGCGGGTGCTGCGGCGGTGGGCGCGACCCTGATCGTGGCGGCCGCGACC
CTGGCGTCCAAGCCTCTGATCACCCTGGACGGCCCTGCTTACACCAGCGTCTTCCAGGGC
GTGATCCGCTGGAACAGCTTCGTCTTCGTGCCGGTGATCCAGTCGGTCTATGGCTCGGAA
GGCACGGCGCTGGCCGCCGTCGCCATCGCCTTCATCATTCCCGTCACCAACATCGCCTGC
GTCGCCGTGCTGGCGAAATGGGGTTCGCTGCGGCGCGAGCCGTCGGTCGTCGGCCTGATC
AAGTCGATGCTGGCCAATCCAATCCTGCTGGCCTGCCTAATCGGCCTGGCGCTTAACCTG
TTGCGCGTGCCGCTGATCACTGGCCTGTCGGATGCGATGGACCTGCTGGGCGCCGCCGCC
CTGCCCTTGGGCCTGATCGTCGCCGGGGCGGGTCTGTCCTTCGCCGAGGTCAAACGCCGC
CGCACCACCATCGCCGCTGTCAGCCTGGTCAAGCTGGGCGTCATGCCGCCGCTGATGTGG
TTCATCGCCTGGGCCCTGGGCGGCGACAGCCTGGCGCAGGGCATCGCCCTGATCTGCGGC
GCCGCGCCCGGCTCGGCCGCCTCCTACATCCTGGCGCGTCAAATGGGCGGCGACGCCCCC
CTGATCGCCGGCGTCATCGCCCTGACCACCGTGGGCAGCGCCGTGGTCATTCCCATCCTG
CTGGCCCTCTTCCACTTCACCTGA