METABLE2 Genes

PROKKA_00010 Brevundimonas

GenomeBrevundimonas ctg_1:9970-10548
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00010 hypothetical protein
ATGGTGAAGACGATCGACACGAAGGACGATGACATGCGCATAGCGACAGCGGCGATGACG
GCTTTTGGGCTTGTGCTGAGTGGGTGCGGACAGTCCGACGCGCCGCCGAAGAGCCCGACC
GCGCAGGATACTCAGACCGCGGCAGCCGCGCCGACGCCGAGCGCGATCACGCGTGCGGCC
CGGCCACCGACCACCAAGCCGGTCGGGCCTGCCGAACGGCGCACCGCAGCTACTCGCGAA
GAGATCGGCACGGCGGCCGACGTGTCGCAGTTGCAGGCCCTGCCGGACCAGAACGCCAAG
GTCTTCAGTCTGTCGGGAGGCGACCCGGCGGTGAATGGTCTGGTGACCTATTTCGCCCTG
TTCGGCGGCCCGGCCGAAGGCTGGCGCGCCTATCCTTTGGGCGACTACGCCGAATGGAAG
GTCGTCGAGGCGAGGGCTGGGCGCGTGGTCCTGGCGGTGCGTCAGGATACGGCGGGGGCG
AACGGCGACATCCTGAAGGTGGAGCGCGCGGTGCAGATCGACTTCCCCTCAAGCGGCGAG
ACGCCGCCGGATGCCGTGTCCGTCAGCACGTCGCAGTGA