METABLE2 Genes

PROKKA_00013 Brevundimonas

GenomeBrevundimonas ctg_1:12458-13696
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00013 hypothetical protein
ATGCAAGAACAGCTTCTAAGAGAGATTGCCAACCAATACTTGGTGCCATTGTTTTCAGGC
GCCTATTTGACGCCTGCTGTCGATAAAAAGACGAGCTCACAATTGGTCGCTTGGCGCGAT
CCAATGTCTATAGCTTTCAAAGTAGAGCGTAGTGACAGTTATCGTTTAATATTGACGCGT
CCGCAGCGTTTTGCGCAACCGGGAGAAGTGACCCTCACAGAATATCAAGTTGTTCAAGCC
TTTGTGGACATCGTGGGTGGTATGGCGTCACAGCTGGCTTCTGACCTACGGCATGATTTG
CTCTCCACCTTCCAGCGAAGGGTTGTGGCTAGGGCAGTTCAGGGAGCTGCGAGAGAGTCA
TTGATTCTCAATGGTATTGATCGGCTAGCCCATTGGGGTAATCGACTCTATGAAGGCGCG
CCGATATCAGCGTCAATCGGGTTTCGAAATCTGCCCCAAGATGACGGGATTACACTAGAA
GATCTTTCAAAATCAGATTTCGGAGCTGTTATAAGCAACGGATTTGACACGTTGTTAGAG
TTCGATTTTTCGGGGCGTCTTGTTTCGCATCAAAGTAACTTATCCACGTCAGTTGCGGTG
CCATCTTATTGTCCTCTTCGTCAGGCCTACATCGCCGAGTGGACGACAAAGAAAGAAACT
CGTGTAGCGTTATCCCTGAATAGATTGGGGGAGGTTCTCATATTTCGAAATCAAGAGCTG
CTATTTGCCCGACGCTCCGGGCAATGGCATTTTTTGACTCATGATCCAGTAATAATGCAG
ATGGGTATCCCCAAAGATACTCAACTTAGAAAAGCGATCTATGAAACCTGCCTTGATGCC
TCATTCGCGAGAACTGGTGCATGCATTGGGGTTGTCGGTTTTGATGATCGACAAAAATGG
AAAGAAGTAGTTGTACACAAAGACGATTATTTATCTGTCCCTACATCTAGCAAATCCCAA
ACTCTGAAGAAGATTATAGGTAGCCGAACCTACACTCAGCTGGATCGGAGGTTGAGGCAA
GAATTGGCGGCTATCGACGGAGCAACTGTCTTATCCCACTCGGGTCAAGTGCTGGCGATA
GGAGCTATTCTCAAAATTGACGGCGGCAGTACCGGTGGTGGGCGGCTGGCAGCCGCAAAG
GCGCTAAGCAAGGTTGGTTTGGGCATTAAGGTGTCTCAAGACGGAAGCATCACAGGATTC
CGTAAGGGGCGGAAAGACGCCGCATTTAAAGTCATGTGA