METABLE2 Genes

PROKKA_00015 Brevundimonas

GenomeBrevundimonas ctg_1:15326-15529
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00015 hypothetical protein
ATGAAGATCGCACTGACCGCCCTGGCCGCCTCGATGCTGCTGGCCGGCGCCGCAACCGCC
CAGCAAGCGCCCAGCGCGCCGCCGCCTCCGCCGCCCCCGCCGGTCGATCATCAGATTCCG
CACCATCCGGCCCCGCCGCCGGTCGATCCCTCCGTGCCTGCGCCGCCCGCGCCGCCGGCG
CCGCCCGTCCCGCCGTCGGCTTGA