METABLE2 Genes

PROKKA_00016 Brevundimonas

GenomeBrevundimonas ctg_1:15867-17018
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00016 hypothetical protein
ATGAAACGCCTCCTGATGGCTTTCACCGCCATCGCCGCCGTCGCCGGCCCGCTTGCGGCT
CCGATGCAGGCCCTCGCCCAGGAGCAGCAGCAGGACCAGGCTCAGCAGGAACCGCCGCAG
CGCGAAGGCCGCGCCCGCGGCATGAACCGGCCCGAGCGCCCGCAGATGGGTCGTGAGGAC
GGACCGCGCGAGCCTCGCCCCGAACGTCCCAGCCGACCCGCAAACGATACGCCCCGTCCC
GAGCGCCCGTCGGGTGGCGAACGCCCCAATGCTGGCGGCCAACGTCCGGATCGTCCCGAA
GGCGGCTGGAACCGGTCTGATCGTCCGAACACCGGCGGCCAGCGTCCCGACCGCCCCGAA
GGCGGCTGGAATCGGCCTGATCGTCCGAACACCGGCGGCCAGCGTCCCGACCGCCCCGAA
GGCGGATGGAATCGCCCTGATCGCCCCAACAGCGGCGGCCAACGTCCCGACCGCCCCGAA
GGCGGATGGAATCGCCCTGATCGCCCCAACAGCGGCGGCCAACGTCCCGACCGCCCCGAA
GGCGGATGGAATCGCCCTGATCGTCCGAACACCGGCGGCCAGCGTCCCGACCGCCCCGAA
GGCGGATGGAATCGCCCTGATCGCCCCAACAGCGGCGGCCAACGTCCGGATCGTCCCGAA
GGCGGCTGGAACCGTCCCGATCGCCCAAACACCGGCGGCCCGCGTCCAGACCGGCCCGAA
GGCGGCTGGAACCGACCTGACCGTCCGGGCTCGGGCTGGAACAACGGTCGTGACCGCGAC
CGTCAGCACCGCGAGTTCCGCCAGCGCTTCAACGGCGATCAATGGCGGCGGGATTTCTAT
CGCAACCACCGCTCGGACTGGTGGCGCGATGATCGGCGCTTCAGGGGTTACAACGGCGTT
CGCGTCGGCTTCTACTTCGCGCCGGGTTGGGGCTACTACAGCGTGCCGCGCTCATACTGG
GGTCGGTCGTGGTCGGTCGGCCAGTATCTGCCGGATGCCTTCTGGCGCTATCAGCTGAAC
GACTGGCGCACCTACGGCTTGGGCTATCCGCCCGAGGGCACGCGCTGGGTCTCCGTCGAC
AACACCCTGTATCTGATCGACGAATACGACGGCTATATTATCGACGTCATCCGCGACGCC
TGGCGCTGGTAG