METABLE2 Genes

PROKKA_00017 Brevundimonas

GenomeBrevundimonas ctg_1:17181-17765
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00017 hypothetical protein
ATGAACCGCCTCACCAAGGCCGCCGTCGTCGCCCTCGCCCTGTCGACCACGGCCGTGCCG
ATGCTCGTTCAGGCGCAGGACCGCGACCGCCGCGAGTATCGTCAGGATCGCCGTGACGAT
CGCCGCGACTTCCGCCAGGAACGCCGGGAAGATCGCCGCGACTGGCGCGACGGTCGCTAT
GACAGCCGCCAAGACTATCGTCGTGACCGCCGCGACGACCGCCGTGACTACTGGGCGGAA
CGCCGGGACGACCGTCGCGATTGGCGCAACGACCGCTGGGACCGCAACAACAGCAACTGG
TGGCGCGGCCGCTCGGACTTCCGTGGCTACAACGGTCCGCGCTCAGGCTACTGGTATGCG
CCCAGCTACGGCTACTACCGGGTCGAGCCGCGCTACAGCGGCTATCGCTGGCGCACCGGC
GGCTATCTGCCGGCACAGTATCGCAGCTACTACGTCCGCGACCCCTATGTTTACGGCCTT
CGCGAAGCCCCGCGCGGCTATCGCTACGTCCACGCCGGCAACGACATCCTGTTGATCGCT
GTGGCCAGCGGTCTGATCGCCAGCGTCCTCTCGGGCGTCTATTAA