METABLE2 Genes

PROKKA_00018 Brevundimonas

GenomeBrevundimonas ctg_1:18081-18386
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00018 hypothetical protein
ATGAACGCGCAAGAAATGGCGCACGACCTGCAGGCCTACGACGACGGTCTGCCGCTGCCG
ACCCCGGACATGTCCGGCGACGACCTGTTCAAACTGGGCATGATGTATTCGGCCGGATCG
GGCGGTTGCCCGATGGACCGGGTGTCGGCCCACATGATCTTCAACCTGGCGGCCATGAAG
GGTTCGATCGAGGCGCGCGTCTATCGCCGCGAGATGAGCCTGGAGATGGAACGCGAGGAG
ATCGCCGAGGCCCAGAAGGCCGCGCGGCGCTACATTGATCAGGGCGTCGTTCAGCTGGTC
GCCTAA