METABLE2 Genes

PROKKA_00020 Brevundimonas

GenomeBrevundimonas ctg_1:19266-20705
ProductCDS Chain length determinant protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF02706.9
Sequence
>PROKKA_00020 Chain length determinant protein
ATGCGCTCCACCGCACACGTCACCACAAGGCCGCGCTACGGCGTTCTGGACGTGATCGGC
CTGTTGTTCCGCGAACTGCTGCTGATGATCGTCGTCTTCTTGGTGATTCTCGGGCTGGGG
TTCGCCGCCGCCATGACGCTGAAGAAGAGCTACACCGCCACCGGCTCGGTCTTCGCAGGC
GTGGGTCAGGAATACGTCTATCAGCCGCGCGTCGGCACGGCCGAGCGGGGGCAGGCGCCG
CAGGGTGACGAGGTCGCCAACTCCGAAGCCGCCATCCTGGGCTCCAGCGCGGTGCGCCAG
AAGGTGGTCGAGGCCCTGGGCCCCGCCGCCATCCTGGGCGAGCCGCCCAAGGGCAGTCCG
CAGGCCGCGCGTTCCGCCGCGCTGAAGGCCGTCGGCGGCGGCTTGGGCGTCGCCACGGCG
CCGGGCAGCGCGGTCATCCACCTGACCTACAAGGCCGACGATCCCGAACGGGCGGCTCGG
GTCCTGAACACAATCATCGAGCAATATCTGATCTATCGCCGCGAAGTCTTCCAGGACAAG
ACGCCGGCCATCGCCAGCCAGCGTATCGCCTTCGAGGATGAACTCGGCAATGCCGACCGG
GCCTATGAGGCCTTCCTGGCGTCGAACGACATCGGCGACTTTACGGCGGCCAAGGCGACG
CTGGCGGCGACCTATCAGACGGTCTTCACCGATCGGATGTCGACGCAAAGCCAGCTGAAC
CAGACCGCCCAGCGCCTGAACACCCTGGTGGCGCAGCAGGCGGGAACACCGGCTGAGGTG
GCGTTGCAGCAGGATCTGAACATCTCGGCCCAGGACCAGGTGCTGCAACTACGCACCGAG
CGCGAGCAGCTGTTGTCGCGCTATCAGCCCGACGCCCAGCCGGTGAAGGACATCGAGGCG
CGGATCAATCAGCTGCAAGCCTATGTCGCGACCGGCACGGCCGTCGGGGCGAAGGAGGTC
CGCACCGGGCCGAACCCTGTCTGGACCGAGCTGGAAACCACGCGGATCAACACCCGGGCT
GAGCGCGACTCGCTGGCGGCGCGTCTAGCGGTCCTGGATCGGCAACTGGCCGACATCCGT
TCGCGGCAGGCGCGGTTGACCGCGCTGGAATCCGAGAACACGACCCTGGCCGGCAATCGC
GAGGTGCTGAGCGCCTCCATCCGAGAGTTCCAGCAGCGCGAGACCCAGAGCCGCGCCGAC
AACGCCCTGGTCGCCGCCGGCGCCGACAACGTCACCGTCATCGAACGCGCCCAGCCGCCG
GCGACGGGCAAGAGCCTGAAAATCCCACTGCTGGCGGCGGTCTTTCTGTTCGCGGGTTTC
ACCGCCCTGTGCGTCGGGTTGTTGCGCGTGTTCACGCGTCGCGGCTTCACGACCCCGGCC
TCGGTCAGCCGCACGCTGGATATGCCGGTCCTGGCCGTCGCGCCGGCCAAGGCGGCCTAG