METABLE2 Genes

PROKKA_00021 Brevundimonas

GenomeBrevundimonas ctg_1:20753-21454
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00021 hypothetical protein
ATGGTCGACCTGACTTCAGAAATGGTGGGCCTTTGGGCGGCGCTGGGACCGGCGCCGGCG
CACCGCGCGCGCGTGATCCAGTTCGCCTCCGCTGCGACCGGCGAGGGCGTCTCGACCGTG
GCGCGCGAGTTCGCCCGTCTGGCGGCGGTGCGGGCGCGCAAGCCCGTCTGGCTGATCGAT
GGCGATCTGGCGCAACAGGGACAGTTGGAGGCGGTGTCGGCTGAGCCGGATCGTTTCGGT
CAGGTCGGCAAGGCCGCGCAAGGCTCGCCCGACGGATCAAGCTTCTACGCCGTGACGCCG
CGCGTGACCGGGCGCGACGGCAAGCCTGTGCCGGATTCGCGGCTGTTGACCGCGCGTTCC
TGTCTGGGCGGCCGCCTGTGGGTGACGCATTTCCACATGGAAGCGCTGCGGTCCGGGCAC
CGGGTCGAGGCGGTCGGAGAGCCCCGCTACTGGGAGGCGCTGCGGCCCCACGCCGACACC
ATCGTCATCGACGCGCCCGCCGCCGACCGCAACGACATGGCGATCATCCTGGCGCCCTTC
GTGGACATGACGGTCTTGGTGATCGCGGCCGAAAGCACGGCCGCCCATGCCCCGGTCATC
CTGCGCGACGAGATCGAGGCGGTGGGCGGCAAGATCGCCGGCGTGGTCATGAATCGCTCG
ACCTACAAGGAGCCGGGGTTCCTGCGGCGACTGATGGGCTAA