METABLE2 Genes

PROKKA_00023 Brevundimonas

GenomeBrevundimonas ctg_1:23280-26363
ProductCDS TonB dependent receptor
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF00593.18
Sequence
>PROKKA_00023 TonB dependent receptor
ATGTTCCAAGCCGGCTATGCGCCCGCCGCTCGCGGGCTGCGCCGTTCCGCGTCCGCCCTG
GCGTTGACGGTCGCCGTCGTCGGCGCAACTGCCGCCCACGCGCAATCGACGCCGGCGCCG
CAGACGACTGCCCCGGCCACGGACGATGCGGCGCAGGTGGACGACGTCGTCGTCACCGGC
ATCCGGGCGCGGATCGCATCCTCGCAGGCGATCAAGCGCGACTCGGACACCTTCGTTGAC
GCAGTCACGGCTGACGATATCGGCGCGCTGCCGGACAAGTCCGTCAACGAAGTGCTGCAA
CGCATCCCCGGCGTGAACATCAACCGCTTCCAGGGCCCGACCGACCCCGACCACTTCTCG
GTCGAAGGCTCCAACGTCATCATTCGCGGCCTGTCCTACGTCCGCTCGGAGTTCAACGGC
CGCGACGCCTTCAGCGTGAACACGGGTCGCGCCCTGGGCTTCAACGACGTGTCGCCGGAA
CTCCTGTCGAGCGTGCAGGTGTTCAAGAATGCGACGGCCGACAGGATCGAAGGCGGCATC
GCCGGGGTCGTCGATCTGCGCACCCGCAAGGCGTTCGACAGCCGTAAGTTCGTCTTCGGC
GCGACGGTCGAAGGCTCTTATGGCGACCTGCGCGAAAAGCCGGGCCTGGGCTTCTCGTCC
CTGATCAGCAACGTCTGGGACACCCAGTACGGTTCGTTCGGCGCCCTGCTGAGCTATGGC
GAATCCGACCTCTATTCCGAAGCCTACGGCTCTCACCTGACCGACTTCACCTACCGTTCC
GATCTGTCGAACGGCAATGACCGCCGCTATGTGCCGCGCGGCGGCGCAGTGCGGACCCAG
CAGTTCGACCGTTCGCGTTCGACTCTGGACGGTTCGCTGCAGTGGGAATCCACCGACGGC
CGCGCAAAGCTGACCGGCGAATACATCCGTGCCGATTCGACCTCGGCCTGGGGCGAGCGC
GTGGTCGAGGTCGATCTGGGCAGTGGCGGCAATCCGACCCCCTTGCCGGGCCAGTCGTTC
ACCTATGATTCCAACGGCGTCTTCACGAGCGGTTTGCTGGTCAGCAATTCGCCGAACCTA
CAGGTTCTGCCCAAGCGTCAGCGCGATCTGCAAACTCTGACCGAAGACTTCTCTCTGGCC
GCCGAATTCCATCCGACCGATCGCCTGTCGATCTGGTTGGATGCGCAATACAGCAAGGCC
AGCGCCGACGATCTGGACATGAGCGTCTATGGCGCCATCACGCCGCTCTACACCTTGATC
GGCGAAGGGCGTCATGGCGTGCCGGACATCCAGTTCGTGGACGCCTCGGGCCAGCCGTCG
CCCAGCACAAACGATCCGTCGAACTTCTACTATCGTTCGGCGATGGACCACATCGAACAG
TCGGACGGTGATCAGACCGCGTTCAAGGCCGACGTCAAATATGACTTCGACAACTCTCCG
CTGCGCGCCATTCGAATGGGTGCGCGCTATTCGGACCGGGAGCAGACTCGCCGCTACACC
GCCTATAATTGGGGTGCGATTTCCGAGAGCTGGGCTGGCGGCGTCACGCCGTTCCAGACC
ACAGGTCCGCTCGCTGTCGAAGCCTATGACTTCCCCAACTTCCAGCGCGGTCACAATCCG
ACGCCGATGAACGGCTTCTATCCGACAGCCGATCTGATTGCGGCCTATCGAGACGGCACG
CTGCAGGCGGCCTTGGCTGCAGCGAGCAGCTCGGGCTCGACCTGGCGTCCGCTGGATCAG
CGTCCCGGAGCCATCGCCGGCACGCCGTTCTTGCCGGGCGATATCAACAACTCGGCCGAA
CAAACGACATCGGCCTATGTCCGGTTCGACTTCGGCTGGGATGATGTCTTCGGTCCGGAC
ACCGCCGTCACCGGCAACCTGGGTGTCCGCTACGCCAAGACCGACTTCCAGACGCGCGGC
TTCATCTCCAGCCCCAACATCGCGCAGAACTTCGGTGATGCGAACGGTTTCGACCCGCGC
TTCCCTGGTCAGAACATTCCGGTGACCCAGGCCAATGCGGCGGCGATCGCGCAGTTCCGT
TGCTCGACCATCCAGCCGGGGCAGTCGGCGCCGGGCTATTGCCTCCTGTCGAACGACCGT
CTGAACCAGCTGGTCGCCTTCAGCGACGGCAGCTTCCAAGAGGTCGAGCGCGGCAACAGC
TACGACGACTGGCTGCCCAGCCTGAACGTCAATCTGAAGTACAAGGAATGGGTTTTCCGC
GGGGCCGTGTCGCGCGCCATGACGCGCCCGGACTTTGGCGTGACGGCCTTCGCCGCTACC
CTGTTCTACACCGACATGAACCAGGTCCGGGACAATGGCGGCGACGTCAACACCGCCCCG
CTGCTGACCACTTTCACCGGCGGATCGCAGCTGACGGGCGTCCGCGCGTGGAACTACGAC
CTGGGCGTGGAATGGTATTTCAAGCCGGGAAGCTCGCTGACCCTCAACGCCTTCTACAAG
GACCTGTCGGACATCCTGGCCAGCGGCTCGACGGTCCAGCAATTCAGCAACGCGCAGGGC
GTCTCGACCGACGTTCAGGTCAACCAGCAGGTCAATATCGGCTCCGGCTGGATCAAGGGC
TTCGAGGTCGGCTACCAGCAGACCTACAGCTTCCTGCCAGGCCTGTGGAGCGGGCTGGGT
ATCGAGGCGAACTACACCTACGTCGAGCCTTCGACCTTCCCCAACGCCGTGACCGAGCCG
CGCTATGTGGGTCTGGAACTGCCGTTGCAGCAGCTTTCGAAGCACACCTACAACTTCTCG
GTCTTCTACGAGCGGGATCGTCTTTCGGCGCGTCTGGCCTACAACTGGCGCAACGGCTTC
CTGCTGACGCCGCGCGACGACGTGAACCCGTTCTCGCCGATCTTCAACGACTCGACGGGT
CAGCTTGACGGTTCGATCTTCTACACTCTGAACGACAACTGGAAGATCGGTCTGTATGGC
GCCAACCTGCTGGACGAGGTCACCGTCACGCAGCAGCAGACGTCCTATAACCTGAACGGC
GCGAACCAGGCCGGCCCGCTGGCCCCGCGGTCCTACTTCCGCAGCGACCGTCGCGTGACG
TTCAGCCTGCGCTACACCTTCTAA