METABLE2 Genes

PROKKA_00024 Brevundimonas

GenomeBrevundimonas ctg_1:26429-27835
ProductCDS Tryptophan halogenase
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF04820.8
Sequence
>PROKKA_00024 Tryptophan halogenase
ATGAGCGGGTCAGACAAGGCTTGGGTCATTCGAGGCGGCGGACTGGCGGCCTGGGCGGCG
GCCGCCCTGTTGGCCAAGACGCTGCCGTCCGGTCATTCGGTCCTGATCGAAGACGCCGCT
CCTCCCGCGCTTGGTGAAGAGCCCGAGGTCGTGATCGCCGATCCAGACGGTGTGCTCGTC
CAGTTGTCTGACGGCGCCGACCTGTTGGCTCGGGGCCACGGCGGTTTCTTCCTCGGCTCG
CTGCTGCGAAACTGGCGCGACGGGCGAGACATCGCCGTCGTCGAGCAGGAGCCCCTACCT
GGGATCGATGGGGTCGCGTTGGCGGATGTGGTGCTGCGCGCCGCCCGTCAATCTCCTGAC
GCCCCCGACTATGCCACTCTTCTGGCGCCGCTGCAGTTTCAGGCGCGCGTGATGGCGGCC
GGTCGTTACGCCCATCCCAGCCCGGATCGGCAATCGCCCCGCTCTCTTCTTCGTCCCAGA
CTGATGCTGGACGCGCGCGTTTTGACGGCGCGACTGCGGGACATCGCCCGGCGCGCCGGC
GTGCGAGAGGGTCTGGGCGGCACCCGCGAGATCGCGCCCTTCATGACCGTGGACACGCGA
ACGACCAGAGCCTTTGACGGCGACGGCGACTGGACCGCACGCCTGGGCTACGACCGCTGT
CTGACCGTGCGCTACGCGGGTGGCGATCACGCGCCGCATCTGGATATGACCAACCTGTTC
GAAGGGCTGGCCAGTCGCAGCCCCCTGCCCGGCGGCGGTTTCGCCAGCCTGGCCTACGCC
GCAGATCGCACCACCGCTGACGTTGCGACGGCGGCGCTGGCGGCCTGGCTGGGTGATGTT
GATGTCGCCGCCCTGTCGGAGGTCGCCCTCGCCCCCGGCTTCAGTCCGCATCCCTGGAGC
GGGCCTCGTCTTGCTCTTGGTCCGGCGGCGGCGCGCTTTGGCGACGCCTTGGGCCTGGAC
AGCGTCGTGCTGGAGCGACAGCTGACACAACTGATCGCATCGCTGCCGGGCGCGTCCGAG
CAGATTCCAGCCTGCGCGGAGGCCTATAACGAGGCCGTTGTTCGAGACATCGCGCACCGC
GCGGACCGACTCCATTTGATCCTTCTATGCGGATCGCAAGGCCAACGACTAGCCCCGGCT
GGCGACGACCTGGCGCGTCGCATCGCCCAGTTCACGTCTCGCAACGCCGGCGTCGGCCTG
GATGGCGATCCCTACGACGCACAACACTGGACCCTGCTGATGGCCGGCCTTGGCCTGACG
CCGCGCCGTTACGACATCCAGGCCGACCGTCTGGACATCAAGAGCGCCACGGCTTCGCTG
GGGCGAATGGTCATGGCTTTCGACCAGACCTTGGCCGCCCTGCCCGCCCATTCTCAGTTC
ATCGAACGGCTGCGCGAAGGCGGCTGA