METABLE2 Genes

PROKKA_00030 Brevundimonas

GenomeBrevundimonas ctg_1:36672-37934
ProductCDS Major Facilitator Superfamily protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF07690.10
Sequence
>PROKKA_00030 Major Facilitator Superfamily protein
ATGGAGGAGGGCGAAGTTTCAAGTTTTTCCCATCCCCGCCGTACACGACTGATCGTTGCA
GCGTACTTGGTGCTGTTTCTGGCCGCCTTCATTGGCTTGGCGCCCCTTTTCCAGATCATC
GCCCCGCTTCATGCGGCTGGGCTGGATACGGATTCCAAAACGGAAATCCTGAGCCGTGCG
ATGTTCTGGGGCGCCATTACGGCTGCTGGCGCCAACGTCGTCATGGGGACCATCAGCGAT
CGAACCACATCACGGTTCGGGCGTCGAAGGCCTTGGATTGCGTTGGGCGCGCTCCTAACG
GTTCTGAGCTATGTGGGGATATGGCGGTCGTCGACGCCGGCTGAGTTCGTCTGGGCCTTG
ATCGGCTTTCAGCTGGCTTTCAACGTTCTGGTGGCGCCGCTTTCAGCGGTGTTCGCAGAT
CGCGTGCCGATCGCCTTGAGAAGCACCGTTTCTGCGATGCTGGGACTGTCTTATCCGCTC
GCCGTGGCGCTGGGGTCCAGCCTGATGGCGCTCGGTCCTCAATATGAGCCCGGACGATTA
GCGCTCCTTGCCGGCATTCTTCTTGCCGCAGCCCTTATCTTCTTGATCGTTTACGACGAG
CCGCGCTCCTTTGAGCGATCAGAGACGGCGCCGTCTTCTGTTCCCAGCGGGATAGGCGCG
TTCCTCGCGCCATTCAGATCACGAAACTTCGTCGTGGTCTGGACCGGCCGCCTTTTCATC
GCAACAGGTTATGCCCTGGTCAGCATGTATCTGCTGTACTTCCTCACGGATGCGGTCGGA
TGGCCCGGCCGCTCTCCCGAAAGAGCGCATGCCTTTTTGACGGGGATCGCATTTGTGGGC
GTCATGGTCGTCGCCGGGGCCGTTGCCCTGTTCGGGCGGCGCATGATTTGGCGACAGCCC
CTCGCGCTGACGGGAGCGCTGTTGCTTTGTGCAGCGACCTCCATTTTGGCGATCGCACCA
TCCTGGACAACGGCGGTGTTCGCCCTCGCGGTCTATGGCTTGGGCCAGGGCGCCTATGGG
GCCGTGGAGATGGGGTTGATGGCGGATGCTCTACCCACCCAGCACAATCGCGGGAGAGAC
ATGGGCTTGAACAATCTGGCTGTCGCCTTGCCTCAGGCGATGGCACCGGTCGCCGCTTTC
ATTCTCCAGCGTTCGGGCGCCGATGTGCGAGGCCTCTATGTCGCAGCGGCGGCGTGTTTT
GCGGTTTCCTTTGTTGTGATGAGCCTATTTCGAACAGGTCGAGCGTCGCAGAGCACAAAC
TAG