METABLE2 Genes

PROKKA_00031 Brevundimonas

GenomeBrevundimonas ctg_1:37989-38921
ProductCDS Glycosyl transferase family 2
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF00535.20
Sequence
>PROKKA_00031 Glycosyl transferase family 2
ATGCGCGACGTCGCCGTCATCATCCCGACCCTGCGCCGCCCAGACAGTCTGGAGCGAGCT
ATGCGCTCCGTCTTCGCCCAGATCGGATCGCTGCATCGCGTCGCCGCCATCGTCGTCGCC
GACAATGACCCGCTGGGGTCCGCCGCCCCCCTGATCGAACGGCTGCGCGCCGAGGCGCCC
GTGCCCCTGACCTACGCCCACGCCCCCATCCCCGGTGTGGCGACGGCGCGCAACATCGGC
CTGTCCGCCACCGACGCGACCCTGATCGCCTTTCTGGACGACGACGAAGCCGCCTCTCCC
GGCTGGCTCGCCGCCCTGCTGGACGCCCAAACGCAGACCGGCGCCGACGTCGTCTTTGGA
CCCATTCGCGGGCGGGTGCCGGAAAACACCGGCTGGACTACCGCCTATCTGGAGCGCTTC
TTTGGCCGCGAGGGCCCGCGCGAGACCGGCTTGACAGACGACATCCACGGCTGCGGCAAC
AGTCTGATGGTGCGGGCCACCGCCCTGTCCGGCGAGGCCCCCTTCGATGTCGCCATGAAC
GAGACGGGCGGCGAGGACGACCGCCTGTTTACCGCCCTGTCGGCGCGCGGCGGCCGGTTC
GGATGGGCTGCCGACGCCTGGGCGGACGAGTTCGCTCCGCCCCACCGCGCCACCCTGAAA
TACGCCCTGACCCGCGCCTTCGCCTATGGCCAGAGCCCGACCCAGATGGCCGCGGACCGC
CGCGACTGGCCCGGCGTCATCAAATGGATGCTGGTCGGTGTGGCCCAGACCGGCGTCTGG
GGCGCCGCGTCCGTCCTTTGTGCGATCCTGCGGCGTCCTGACCGCGCAAACGTCTACGAC
CGCTGCGCACGCGGTCTCGGCAAGCTCTTCTGGACCAAGGGGTTCGAGCCGAAACTCTAC
GGTGCGGCGATGCTGTCGCGGTCGGACGTCTGA