METABLE2 Genes

PROKKA_00032 Brevundimonas

GenomeBrevundimonas ctg_1:38924-39856
ProductCDS Glycosyl transferase family 2
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF00535.20
Sequence
>PROKKA_00032 Glycosyl transferase family 2
ATGAGCGCCCATATCTTTGAAAACGCTGCTTGGTCTCAGGCCGAGCCGACGATCTCGGTC
CTGATCCCCTTCCTGCGCGACGATCCGCAAGAACTGCTGCGTCATCTGGACAGCGAGGCC
CCGGCCCTGTCCGGCGCAGTCGAGCTGATCCTGCTGGACGACGGCACCGCTGACTCCGAT
CTGACGCAGCAGCTACAAACGACGATCGATGCGTTGCGGCTGCCCGTCCGCCTCATCACC
CTGGCCGCCAACGAGGGCCGCGCCAGGGGCCGTAACCGCCTGACCACCGCCGCCCGTGGC
GAGGCCTATCTGTTCCTCGACAGCGACATGCGGCCCGATACGGAGGCCTTCCTGCGAAAC
TGGCTGCGACTGGTCATCGACAACGCGCCCGCCGTAGCCTTCGGCGGCTTCTCGCTGGAT
CAAGCGCCGACCGACGCGCGGTTCGCCGTTCACCGCGCCCTGTCCGGCGCCTCGGAATGC
CTGTCCGCGTCCCAGCGCACCATGACGCCCGAGAAATACGTCTACACCTCCAATCTGCTG
GTGCGTCGCGACGTATTCGCCGCCGAATCCTTCGATCCCGGTTTCAGCGGCTGGGGCTGG
GAGGACGTGGAGTGGGCCATGCGCGTCTCGCGCCGCTTTCCCGTCGTCCATATCGACAAT
CCCGCCACCCATATGGGCCTGGACACGGTCGAGGATCTGGCGCGCAAGTTTGATCAGGGC
GCCGGCAACTTCGCCCGCGTCGTCGCCCTGCACCCCGCCATCGTCCAGACCTATCCCAGC
TACAAGGCCGCGCGCGCATTGAAACGCCTGCCCGCCCTGCCCCTGGCGCGCCGCATGCTG
AAACAGGCCGCCCTGACGGTGGCCCTGCCGGTCAAGGCCCGCGCCTTCGCGCTCAGGCTC
TACCGCGCCGCCGTCTATGCGGACGCCGTCTGA