METABLE2 Genes

PROKKA_00033 Brevundimonas

GenomeBrevundimonas ctg_1:39853-41298
ProductCDS colanic acid exporter
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK10459
Sequence
>PROKKA_00033 colanic acid exporter
ATGTTCTGGCGCGGCGTCTGGGGCTATCTGCCGGCCCAGATCGTCCAGGGGGTCGTCGGT
TTTCTGACGATCTTCGTCTTTACGCGCCTGCTCAGCGCCGACGACTTCGGCCATTACGCC
CTGGCGTTTTCGGTGACGACCCTGGCCCACACCGTCACTTTCACATGGCTTGAGGCGTCG
ATGGCGCGCTTCTGGGCGGCCGAGCGTACGCCCGAGGGAATGGCGACCCATTTCGCCAGT
CTTTACCGCACATCCTTCACCATCATCGCCGTCTTCACCCCGATCGCGGCCCTGATCGTG
TGGCTGGCGCCGCTGACGCCGGCGTTAAAAATCGCCGTCGCCTTCGGCCTGGCCGGTGCG
CCGGTGCGCAACCTCGCCAAGCTGGCGCAGGAGCGGTATCGCGCAGCGGGCGAGGTGTCA
AAATCCGCCGCCGTGGACATCGGGGTCGCCGTATTGGGATTCCTGGTCGGGGCCGGGTTC
GCGCTGGCCGGCGCCGGCGCGGCCTCGCCCCTGCTGGGCCTGGCCATCGCGCCCCTGTTC
GCCCTGCCCTTCATCCTGCCGGGCGAGTTGCGTCAGTCGACGGGCGGGACAGTGGATCGC
ACGCGGCTGAAGGCCTATGCCCTCTACGGCTATCCCATTGCGGCGTCGCTGACCTTGGCG
CTGGTGCTGGCGTCGACGGATCGGTTCCTGCTGGCGGCCTTCATGGATGCGGCGGCGGTC
GGCGCCTATCACGCCAGCTACAGCCTGGCGAACCGGACACTGGACGTCATCTTCATCTGG
CTGGGTGCGGCCGGGGCGCCAGCCATGGTCATGGCGCTGGAGCGCGGTGGGCGTGAGGCG
CTGCGTCAGACGGCCATCGAACAGGGTTCGACCCTGATCCTGATCGGCCTGCCCGCCGCC
GTGGGCCTGTCGCTGGTCGCGCGACCGCTGGCGGAGCTGATGATCGGCCAGGATCTGCGC
AGCGCCGCTGCGCTGGTGACGCCGTGGATCGCCGCCTCGTCCTTCCTCTCGGGGATGATC
GCCTATTATTTCGGCTTCGGCTTCACCCTTGGAAAGAAGACCGGCCTGTTGCTGGTGACG
ATGGCGATTCCGGCTCTTTGCAACGTTGCGCTGAACCTGGTGCTGATCCCCCGCATGGGC
GTGACGGGCGCCGCCGTCTCAACCGCCGCCAGTTTCGCCATCGGCCTGATCGCCTGCATC
CTGCTCAGTCGCCGCGCCATCGCCCTGCCGATGCCTTGGGAGGCGCTGATCCGCTGCGGG
ATCGCCTCCGCCACCATGGCCGGGGTCGTCTGGTTACTGCCGCCGCTGGGCGGTTTCTTG
GAGCTGATGCTGGACGCCGGTGTGGGTGGTCTCGTCTATGCGGTCGTCGCCCTGACGCTG
AACGCCGCCGGGGTGCGTGACGTGCTGCTGCGCCTGATCCGCGCGCGTCGGAGCGTGACG
GCATGA