METABLE2 Genes

PROKKA_00035 Brevundimonas

GenomeBrevundimonas ctg_1:42934-43025
ProducttRNA tRNA-Ser(gct)
InferenceCOORDINATES:profile:Aragorn:1.2
Sequence
>PROKKA_00035 tRNA-Ser(gct)
GGAGACGTGGCCGAGTGGCTGAAGGCAACGGTTTGCTAAATCGTCGTACCCCGTAAGGGG
TACCGAGGGTTCGAATCCCTCCGTCTCCGCCA