METABLE2 Genes

PROKKA_00036 Brevundimonas

GenomeBrevundimonas ctg_1:43123-43848
ProductCDS Fatty acid desaturase
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF00487.18
Sequence
>PROKKA_00036 Fatty acid desaturase
ATGTTCGCCGTCACGCCAATGTCACGGGTCGTCCCGAACCAGGCCCTGATCGGCCTGACG
CTGGCTGGCCTGATCGCCGCGGTCTGGCTGACCCTGCACATCTACGGCGTCTATTTTCAT
CGCTGGACGATCTGGAGCATCCTGACCGTTCCGCTGATCGTCGCCGTCCAGACCTGGCTA
TCCGTCGGCCTGTTCATCGTCGCCCACGACGCCATGCACGGCTCGCTGGCCCCGGGACGC
CCACGGCTGAACACGGCGATCGGCAGCCTGGCGCTGGCCCTCTACGCCGGATTTCGGTTC
GCGCCTTTGAAGATCGCACACCACGCCCATCACGCTGCGCCTGGTACGGCGGACGATCCC
GACTTTCACGCCGACGCCCCGCGCGCTTTCCTGCCCTGGTTCTACGGCTTTTTCCGCACC
TATTTCGGCTGGCGAGAACTGGCCGTTCTGACGGTGCTCGTGGCCGTTGCGGTGCTGATC
CTCGGCGCCCGCATGCCCAATCTTCTGGCCTTTTGGGCCGCGCCCGCCCTGCTATCGGCG
CTACAGCTTTTCACATTCGGAACCTGGCTGCCTCACAGGCATACCGACGACGCTTTCCCC
GACCACCACAACGCCCGCACCAGCCCCTTCGGCCCGGTCCTGTCGTTGCTCACCTGCTTC
CACTTCGGCCGCCACCACGAACACCATCTGACCCCCTGGAAGCCCTGGTGGAGTTTGTTC
AGCTAG