METABLE2 Genes

PROKKA_00037 Brevundimonas

GenomeBrevundimonas ctg_1:43971-45095
ProductCDS Lycopene cyclase protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF05834.6
Sequence
>PROKKA_00037 Lycopene cyclase protein
ATGGTCGGCGGCGGCCTGGCCAATGGCCTGCTGGCGCTGCGGCTGTCGCAGCTGCGGCCC
GATCTGGACGTGCGGATCGTCGAGGCGGCGCAGACCCTGGGCGGGGTCCACACCTGGTCT
TTCTTCGACAGCGACCTGACGCAGGCGCAGCGCGACTGGATCGCGCCCTTGGTCGTGCAT
CGCTGGCCGGGATACAGCGTCCGTTTTCCCCAGTTCAAGCGCGCGCTGTCGACGCCCTAT
TGCAGCGTCACGGCCGAACGGTTCGCGGCGGTGGTCGAGGCGGCCTTGCCCGGAAAGGTC
ATGCTGGGCGCGCCGGTCGCCTCGGTGTCGCCGACCGAAGCGGTGCTGGCCGATGGACGG
CGTCTGAGCGCCAAGGCGGTGATCGATGGGCGCGGGCCGACCGCGACGCCGGATCTGGCG
CTGGGTTTCCAGAAATTCGTCGGGCTGGAGGTTCGGCTTGCAGCGCCGCACGGCCTGACA
ACACCCATCGTCATGGACGCCTGCGTCGATCAGGCCGGGGGCTACCGGTTTCTTTACACC
CTGCCGTTCGATGATCGCACGCTGCTGATCGAGGATACGCGCTACACCGACGGCGATGCG
CTGGATCGCGCGGCGTTCCGGCAGGGCGTGCTGGATTACGCCCGCGCGCAGGGCTGGGAG
ATCGAGACGATCTTCCGCGAAGAGGACGGCGTCCTGCCCGTGGCGCTTGATGGGGACATC
GGCGCGCATTTGTCGCGAATGGGGCCGACAGCGCTCAGCGGTCTGCGCGCCGGGCTGTTT
CACCCGACCACCGGCTATTCGCTGCCTGACGCGGTGCGCCTGGCCGACCGGTTGGTGCGG
GATTTCGAGCCGGCGACCGTCGCCGAAGACATCCGCCGCCATGCGCATGACGTATGGGCC
GGACGAGGCTTTTATCGGTTGCTGAACCGGATGCTATTCCGTGCGGCGCGGCCCGATGAG
CGATACAAGGTGCTGGAGCGGTTCTATCGTCTACCCCAGCCTTTGGTCGAACGCTTCTAC
GCTGCGGGACCCACACTCGCCGACAAGGCGCGGATCCTGAGCGGAAAACCCCCGGTGCCG
ATCGGCGCCGCACTGACCTGTCTGGTCGAAAGAGGACGTGCGTGA