METABLE2 Genes

PROKKA_00040 Brevundimonas

GenomeBrevundimonas ctg_1:47509-48576
ProductCDS ABC-2 family transporter protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF12698.1
Sequence
>PROKKA_00040 ABC-2 family transporter protein
ATGATGGCGGTGGCGGGCGCCTGGGCGAGAGGGTTTTGGCGCGACCGCGCCGGCGTGATC
CTGACCCTACTGTTGCCACCCCTGGTCTATCTGCTGTTCGCAGCGATCTTCGGCGCGGGC
GCGCGCGGCGACATCGACACCACCGTCGTGCTGCACGACGCGTCGCGCACGCCCGCGACG
GCAGCGATCCGCGAGGCGGTGTCGAAGGACATAGGCGATCGTCTTCGTGTCGTCGACGAT
CGCGAGGCCTTCGACCGCGCCGTCATCGACGGTCGCGCTGACGCGGGCATACTGATCCGT
CCCTCGACGCAGGGACCGCCGAAGCTGGTGATCTTTTCCGCCGCCGGCAGGGATGTGGCG
GCGTCGGCGCTTCAGGCGCGGCTGGAGCCGATGGCCGCCGCGCTGTCGGGTCAGGGCGCA
CGACCCGCACCGCGCGTTCAAACCCTGCAGATCGGTCCCCAGGGTGATGTGCAGGCGACC
TATTATGCGGGCGCGGTCAGCGTCATGTTCGTCTTCTTCGCCGCCATGCACGGGGCCATG
GGCGGGCTTGACGAGCGGCGATCCGGTCTTCAGTCACGCCTGGCCCTGGCGCGCGGCGGC
CTTGCGCCCATCCTTGGCGGGCGGGCCGTCTGGCTGACTGCTGTGGGCCTGATGCAGTCG
GCGGCTGTCTTCGTCGCCGCCTGGGTCAAGTTGCCTGACCTGGCCCCCTGGCAGATGGCG
GCGACGGCGGTCACCGCCTTTGCGGTCGGCTCCTGCGCCGCCGGTCTGGCCCTGGCTCTG
ACAGCAGCGTGTCGATCGCGCGAACAGGCCCAGCCGTTGACGACCTTCGTCGTCCTGCTT
CTGGCCGCTCTGGGGGGATCGATGGCGCCGCGCTTTTTGATGCCCGAGGCCTTCCGCGAT
CTCGGCTGGATTACGCCCCACGCCTGGGCCATCGAGGCCTATCAGGCCGTGATCTGGCGC
GGCGAGTTCACCTCGACCGTCATCGCAGCCTGGGCGGTCATGGCCGGTCTTGGCGCAGGG
GGTCTCGTGGTCGCCCTGATGTTGGAGAGGCGGCGCGCGGCTCGCTGA