METABLE2 Genes

PROKKA_00045 Brevundimonas

GenomeBrevundimonas ctg_1:52056-52805
ProductCDS Fatty acid hydroxylase superfamily protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF04116.7
Sequence
>PROKKA_00045 Fatty acid hydroxylase superfamily protein
ATGTTGAAGGACCTTTTCGTCACCACGCTTGCGCTCAGCCTGATCATCGGCGTGCGCTAT
CTGCTGGTCGGCGTCGTGACCCATGGCTTGCTGTGGGGCGGAGCGGGACGGGGGCGTCAG
CTGAACCACAGGCCGCCAGTCGCGAAACGCATCCGCGCCGAAATCATCGCATCTCTGATC
GCCTGCCCGATCTACGCCTTGCCGGCCGCACTCGTCATCGAGTTCTGGAAGCGCGGCGGG
ACGGCGATCTACGACGATATCCATGCCTGGTCGCTGTGGTGGCTGCCCGCCAGCTTCATC
GTCTACATGCTGGCCCACGACGCCTTCTACTATTGGGTCCACCGCGGGCTGCACCACCCG
CGCATCTTCCCCTGGGCCCATGCCGAACATCATCGGTCGCGCGATCCCAGCGCCTTCGCC
TCCTTCGCCTTCGATCCGGCCGAGGCTATCGCCACGGCCTGGTTCCTGCCAACCCTGACC
CTCTTCATCCCGATCCATTGGGGCGTAGCGCTGGCGCTGTTGACCCTGATGACCGCAACC
GCCGTGTTGAACCACGCCGGACGCGAAGTCTGGCCCGCGTCCTGGCTGAAACGCGTCCCC
TTGCGCTGGATGATCACCGCCACCCACCACGATGCGCACCACAAACGCTTCAACGGCAAC
TACGGCCTGTATTTCCAGATGTGGGACCGATGGGCAGGTAGCGAGCTTTCTTCCGCTCGG
GGGAGAGAGGCTGAGACGCCACCGCTTTGA