METABLE2 Genes

PROKKA_00055 Brevundimonas

GenomeBrevundimonas ctg_1:65099-65797
ProductCDS SURF1 family protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF02104.9
Sequence
>PROKKA_00055 SURF1 family protein
ATGGCGGTCGTGGTCGTGGGCGTGGCGTTGTTTGTCGGCTTTCTGGCGCTGGGCGGGTGG
CAGGTTCAGCGCCTGGCCTGGAAGACTAATCTGATCGCCCAGGTGGATGCGCGCGTTCAC
GCGGCCGCCGTCCCAGCGCCTCGCCCGACCCAATGGGCCGGCGTGACGCGCGACAAGGAT
CAGTACCGCCGCGTCACGGTTCACGGTCGACTCCTGCATGACAAGGAAACCCTGGTTCAG
GCGGTGACCGACGCCGGCGGTGGCTTCTGGGTCATGACGCCCCTGGTTGACGACCGGGGC
TTCACCGTCCTGATCAATCGGGGCTTCGTGCCGGCAGGCCGACGTGATCCGGCCGTCCGC
GCCGATGGTCAGGTCGAGGGGCCGCAGAGCGTGACGGGACTGCTCCGGATCACCGAGCCC
AAGGGCGGCTTCCTGCGCGCCAATGATCCCGCCGGTGATCGCTGGCGGTCCCGCGACGTC
GCGGCGATCGCTGCGCGGCGGGGCCTGACGACCGTCGCGCCCTATTTCATTGATGCGGAC
GCCAGTCCGAACCCAGGCGGATGGCCGCGCGGAGGACTGACGGTGATCCGCTTCGCCAAC
AGCCATCTGGTCTACGCCCTGACCTGGTTCGGCATGGCGCTGCTGACCCTGGTCGGTCTG
TGGCTGTTCCTGCGCGACGGCCGGCGTCGGCGGTCATGA