METABLE2 Genes

PROKKA_00058 Brevundimonas

GenomeBrevundimonas ctg_1:67645-68082
ProductCDS HIT-like protein
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:P44956
Sequence
>PROKKA_00058 HIT-like protein
ATGAGCCTGCACGGCGCCTATGACACCAACAACATTTTCGCAAAGATCCTGCGCGGCGAA
ATCCCCTCGGTGAAGGTGTGGGAAGATGACCACGTCCTGGCCTTCATGGACGTGTTTCCC
CAGTCGGAAGGCCACGTCCTGATCATCGCCAAACATTCCCAGGCGCGTAATCTGCTGGAG
ATCGAGCCCGACCTGCTGGCCCGCATGACCGCCGCCCTGCAACGCACCGCCAAGGCGGTC
GAGAAAGCGCTGAAGCCCGAGGGGCTGGCGATCCTGCAGTTCAACGGCGACGCCGGCGGC
CAGACCGTCTTTCACCTGCATTTCCACATCGTGCCGCGCTGGGCCGACCGAGAGATGAAG
GGTCACGGCCATGCGCCGATGGCGGATACGGCGACGTTGCAAGCGCTGGCCGACCGGATC
GCGGCCGAACTGGACTAG