METABLE2 Genes

PROKKA_00059 Brevundimonas

GenomeBrevundimonas ctg_1:68191-68547
ProductCDS Membrane protein of unknown function
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF04020.7
Sequence
>PROKKA_00059 Membrane protein of unknown function
ATGATCCGTTTCATCATCCAGGCGCTGGTCACCATGGCGGGCCTTTGGCTGTCCGCCCAG
ATCGTGCCGGGCGTGGATTTCACCAGCACCGGGTCGCTGATCGCGGCCGCCATCATCTTA
GGTCTAGTCAACGCCTTCGTGCGGCCGATCCTGGTCGTGCTGACCTTCCCGATCACCGTG
GTGACCCTTGGACTGTTCCTGCTCGTCGTGAACGCCGCCATGATTGGACTAACCTCCGTC
GTCCTGGACGACTTCCGGGTCGACGGCCTGTGGGCCGGCATCGGCGCCGCCATCGTGACC
GGCGTCGTCAGCTGGATCGCCGGCGCCTTCATCGGCGGGGAAGAGGGGCGGGGCTAA