METABLE2 Genes

PROKKA_00064 Brevundimonas

GenomeBrevundimonas ctg_1:74669-75214
ProductCDS Polymer-forming cytoskeletal
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF04519.7
Sequence
>PROKKA_00064 Polymer-forming cytoskeletal
ATGTTCACCAAGAGCAAATCCTACGACAGCGGATCTAACGGCCTGGGCATCCCCCCGGCG
CCCGAACCGACCACGCCCACGCCGACGGCTGCGAGCACGCCCTCCCTGCCTGCCACGACG
CCTGCGCCGCGCGCGCCCGAACCGGCTCGTCCGGCGGCCCGGTCCAGCAATCTGTCGACC
CTGTCGGCCGGCGTGAAATACGAAGGCAACATCTCCGGCGCGGGCGAGCTTCAAGTCGAC
GGCTCGCTGAAGGGCGACGTCCGCGTCTCGCGCGTCGTGATCGGCGAAGGCGGCTCGGTC
GAGGGCACGGTCCATGCCGACGTCCTTGACGTGCGCGGCCGCGTCTCGGGCGCCATCGTC
GCCAAACAGGTCAAGCTTCACGCCACCGCCCGCGTCGAGGGCGACATCACCCAGGAACAG
CTCGCCATCGACCAGGGCGCCTGGTTCCAGGGCCGCTGCAACCAGGCCAAGCGCGACACC
CCTGGCGCCGCCATGCTGGAAGCCCCCGCGCCGAAGGCCGACAAGGCCGACAAGACCGCC
GCCTGA