METABLE2 Genes

PROKKA_00067 Brevundimonas

GenomeBrevundimonas ctg_1:77379-77582
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00067 hypothetical protein
ATGCCCAAGCGCTCGCCCTACGGTCCGCAGATGACCTTCCCTGAGAAGCGCAAATTTTTA
AACGACCGCCTCCACCTCGTTGTGGGTCTGCTCACGCCGTGCTTGGTCGTCAGCGGCACA
TCGTCCGAGCCGTCTTCCGTGTTCCTGACATGGACCGTAGTCGTCGCCCTATTTGCGCTG
GTCCTCAACCGGGTGATTCCCTGA