METABLE2 Genes

PROKKA_00068 Brevundimonas

GenomeBrevundimonas ctg_1:77734-77922
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00068 hypothetical protein
ATGAAGTTCTTCGTCCTTTTTGCGCTGACATTCGCCTATACCTTTGCGCTGTTGCTCTTG
AGCGAGGCCGCGCCCACGCCTTTGCCGCACATGCTGACGGTGGCGCTTTGCGGCGCCATC
GGGGCGTCTCTGGCGAACGCTACCTGGTGGCTGGTCGAGCGAAAGCTGCTTGGCAAGCCC
ACGCACTAG