METABLE2 Genes

PROKKA_00069 Brevundimonas

GenomeBrevundimonas ctg_1:77994-78500
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00069 hypothetical protein
ATGCGTCTGCCCCTGATCCCGCATCCGACATCCAGCCCGGCGGGGCTGACGCTCGAGGTC
GAGGCGCGGCGGGCGGGGCGGGTGCTGAGCCTGGAGTATGTGCTGGCTGGACCGGTGGAG
CGGGTGTGGCGGCCGGAGGCGGCGGCGCGGGTGCGGACGGAGGGGTTGTGGCAGGCGACC
TGTTTCGAGGCCTTCGTGCGGACGGCGGGCGGCTATGTCGAATACAATCTGTCGCCGTCG
GCGGCGTGGGCGGCCTATCGGTTCGACGGCTATCGCGAGGGGATGCGGGAACTGGAGATA
CCGGCGCCCTTCATCGTCACGCGGTCGGCGCCGGAGCGGTTCGTATTGACGGCGGACGTG
ACCTTGCCTGACGATATGGGCGAGGCCGTGGGGCTGACGGCGGTGATCCAGGGGTTCGAT
GGGGCGATCGCCTATTGGGCGCTGGCGCATCCTTCGGATAAGCCGGACTTTCATCATCCC
GACTCGTTCGCGCTGGACCTGACATGA