METABLE2 Genes

PROKKA_00070 Brevundimonas

GenomeBrevundimonas ctg_1:78497-79699
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00070 hypothetical protein
ATGAACTTCGGCCTCGACCGCCTTTTGTCCGACAACGCCCTGCGGGCGCAGCTAAAGGGG
CGACGCGTGGCCTTGCTGGCGCATCCGGCGTCGGTGACGAAGGATCTGACCCATGCGGTG
GACGCGCTGGCCGCCTGTCCCGAAATCCGGCTGACCGCCGCCTTTGGCCCGCAGCACGGG
ATGAAGGGCGATCTGCAGGACAATATGATGGAGAGCCAGGATTATCGCGATCCGGTGCAC
GGCTTTCCCGTCTTCAGCCTTTACGGCGAGGTGCGGCGCCCGCGCGACGAATGGATGGCC
GAGTTCGACGTGCTTCTGGTCGATCTGCAGGACCTGGGCTGCCGCATCTATACCTATGTG
ACGACGCTTCTGTACGTGCTGGAGGCGGCGGCGAAACACGGCAAGTCGGTCTGGGTGCTG
GATCGGCCCAATCCGGCGGGACGGCCGGTGGAGGGGATGACGCTGAAGCCCGGCTGGGAA
AGCTTCGTCGGGGCCGGGCCGATGCCGATGCGGCACGGGATGACGATGGGCGAACTGGGC
CTGTGGTTCATCGACCAGTTCAAGCTGGATGTGGATTATCGGGTGGTGGAGATGCAGGGC
TGGGCGCCCGAGGCGGGGCCGGGCTTCGGCTGGCCGCTGCTGGACCGGTCGTGGGTCAAT
CCCAGCCCGAATGCGCCGAACCTGTCGATGGCGCGCGCCTATGCGGGCACGGTGATGCTG
GAAGGGGCGACGCTGTCGGAAGGGCGGGGGACGACACGGCCGCTGGAGCTGTTCGGAGCG
CCGGACATCGATGCCCGGGCGGTGATCGCGGAAATGCACGCCTTGGCCCCGGAATGGCTG
GGCGGCTGCGTCTTGCGCGACATGTGGATCGAGCCGACCTTCCATAAGCACGTCGGAAAG
CTGTGCAGCGGGGTGCAGATCCATGTCGATCACCCCGGCTATAACCACGCCGCCTTCAAG
CCGTGGCGGGTTCAGTCCCTGGGCTTCAAGGCGATCCGGCGGCTGTATCCCGATTACGAT
CTGTGGCGAGATTTTCCGTATGAATATGCGTTCGGCAAACTGCCCATCGACGTGATCAAC
GGCGGGCCGGGCCTGCGGGAATGGGTGGACGACGCGGGGGCTGAGGCGGCTGACCTTGAA
GCCGCCGTTGGGCCTGACGAACGGGCCTGGGCGCAAGAAAGAAAACGCTTCCTGCTGTAC
TGA