METABLE2 Genes

PROKKA_00071 Brevundimonas

GenomeBrevundimonas ctg_1:79709-80824
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00071 hypothetical protein
ATGTTAACGCGCCGCTCCGTTCTGCTCACGCCTGCCGCCCTTTCGCTTGTGGCGGCCCAT
CCGAAGGCCGCCCTCGCATTAGATGTCCAAAACGTACGCCCGCGTAGCGAAATGGCGTCA
CTATTCGTTTCGCTTGACCGATTATTGATCATAGCGCGGATCGCAAACGGGATCGCCGCG
CCCATGATCTTCGATACAGGAACGAGTGGATCGGCGATCGATACTCCCTATGTGACAGCC
CTTAATTTACAAAAGACCGGAGATGCAATCACCATCGACGGCGCCACTGGCAAACCTCTT
GAAGATCGATTCTTGACGACATTGCCGGACGTCAATTTGGGAGGCATCGCCGTCGGCGAT
CAGGATTTCGCCGTCTATTCGCATCCTTCGCCCAACGAAGCTGGAATTGTCGGTCCCTAC
ATTTTTGGCGACAGGCTTGTATGTCTTGAGTTGTCGCATGATCGACTTCGGGTTCGTGAC
AAATCTCGCTTCACCCTGCCAACCGGCGCATCCTACCCCTACCTCCCGGACGAGCGGCCG
GGCATTACGGTCGAGGGACCTGGTTTTAGCGTCCTGGGTCTTATGGACACGGGGCACACA
GGCAGCTTGACGCTGCCGCTCGCCATGGCGGCGTCGCTTCCGCTTGAGAAAGCGCCGACC
GTGATTGGCGCGGCCACTTCGGTCGGCGGCACTCAACCCATCTATGGGGCTCGTATGAAG
GGCGCTATTCGTGTCGGCCCACTCGTCATCACGGATCCTGAACTACAATTCTACGGTCAG
AGGGTGAATGTGGGCCTCCACCTTCTGCGCCAAATGACGATCGTGATGGACCCGGTCGGG
AAGCGAAGCTGGGCTACGACGCCCGACAGACGCGCCGCGTCGCCCCTATCGAACTACGCC
GGACGGTACGATGGAATCGAGATACGCGTAGAAGGGGAGCGCCTGATCTATCAGCGCGAT
GGCAGAGCGCCCCGCCTCCTGACGCCACATGATGGCGACCTCTTTGACTTCGCCAACGAT
CCGGTAGTTCAGATCCAGTTCGTACGAAATGAGAAAGGCATTGTCGGCTTCGACATCATC
GAACGCACCTTGACGGCAGTCGATCGAACCGGATGA