METABLE2 Genes

PROKKA_00074 Brevundimonas

GenomeBrevundimonas ctg_1:83937-84197
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00074 hypothetical protein
ATGGGCATGGCCGATGCGACCGACATCACCGGCGGCGTGGTTCACGACTTGCCGGACGAC
CTGCGCGCGGCGTTGGTCGCCGCGCCTGACGCCCTGGCGACCTGGCGCGACATCACGCCC
CTGGCCCGCAACGAATGGATCTGCTGGATCGAGTCCGCCAACAAGTCGGAAACCCGGCGC
AAACGGCTGGATTGGGGCCGGGCGAGCTTGACCGACGGCAAGCGCCGCCCCTGTTGCTGG
CCCGGCTGCCCTCACCGTTAA