METABLE2 Genes

PROKKA_00075 Brevundimonas

GenomeBrevundimonas ctg_1:84233-85051
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00075 hypothetical protein
ATGCGTCCGCCCCTTCTGATCGCCTTGATCGCCTCTCTGGCCTTGCCCACGGCCGTTGCG
GCTCAGTCGACTCCCGCACCAGAGCGCGATTTCTGCGCCGATCGCCCCGGCAAGGGCACT
CCGACCTGCATCCTCGACAAGGGCCGCTGGCAGGTCGAACTCGGCCTGTTCGACGGCGCG
CGTCAGACGGACGGCACGACACGGACCGACACCTGGGACGCCGGCGACCTGTTCGTGCGC
TATGGCCTGACCGGCCTGACTGAGCTTCAACTCGGACTCACGACCTGGAACCACGAACGC
ATTCTCGACCGCGCGACCGGCGATCGTGATGTGGCTGACGGCGTCGGCGATCTCAGTCTC
GGCCTACGCCATTCTCTGGAAAACCCGGATGGCTCGGGCCTGTCCGTCGCGATTTCCGGC
TTCATCACCGCGCCCACGGGTGCCCGCGACATTCGCGCCGACGGTTTCGAGGGCGGCGTC
ATCCTGCCGGTCTCCATCCCGCTGAACGACGACTGGAGCCTGGCTTTGTCACCCGAAGTC
GATTGGGTCTCGGACGCGGACGGGGACGGCCGCCACGCCGCCTACACGATGGTCGCCGGC
GTCGGCCGCGGCTTCGGCCGCTGGGATCTGGGTGCCGAGCTTTGGGTTAGCCGCGACGAT
GATCCGGTGGAAGCGACCACCCAGTCCACCTTCGACCTGACCGCCGTCTGGTCGCCCCCG
TTCCTGCCCGACGCCCAACTGGATTTCGGTCTCAACTTCGGCCTGAACGACGACAGCCCG
GATGTGGAGTTCGGAGTCGGTCTCGCACGGCGGTTCTAA