METABLE2 Genes

PROKKA_00076 Brevundimonas

GenomeBrevundimonas ctg_1:85125-85775
ProductCDS Alpha/beta hydrolase family protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF12695.1
Sequence
>PROKKA_00076 Alpha/beta hydrolase family protein
ATGCCTGAAGTCATCCTGCCCGGCGCCTCCGGTCGCATCGAAGGCCGCTATTCCCCGGGC
AAGCGCCCGAACGCCCCGATCGCGCTGATCCTGCATCCGCACCCGAAGGCGGGCGGACAT
ATGAACAACCCGGTCGCGGTCACCCTGCACCAGCTGTTCCAGCAGCGTGGCTTTGCGACC
CTGCGCTACAACTCGCGCGGCGTCGGCAAGTCGCAGGGCGAGTTCGATTCGGGCATCGGC
GAGCTGGCCGACGCCGCCACCGCCCTCGACTGGCTCCAGGCCAACAATCCCGGCGCCAGC
CAGACCTGGGTCGCCGGCTATCAGTTCGGCGCCTACATCGGCATGCAGCTTCTGATGCGT
CGCCCCGAGACGGACGGCTTCATCTCGGTCTCGCCGCCGTCGAACATGTATGACTTCAGC
TTCCTGGCGCCCTGCCCGGCGTCCGGCCTGTTCCTGCACGGCACGGCCGACACCATCGTC
CCGCCGGTCGAGGTCGAACGCGTGGTCAACAAGCTGCGCACCCAAAAGGGCATCATCATC
GACTACGAACTGGAAGAGGGCGCCAGCCACTTCTGGCAGGACCACATGAGCGCGGTCGAA
ACCCGCGTCGGCGCCTATCTGGACAAGCGTCTGGAAGAAAAGCCGGCCTGA