METABLE2 Genes

PROKKA_00083 Brevundimonas

GenomeBrevundimonas ctg_1:92031-92420
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00083 hypothetical protein
ATGACAGATCAACCGATTCAAGACAGCGACGCCTTCAAGGACGCTTGGGACGAGCCCCAG
AAGAGCGCGCTGTCGCAAGCCGAGCTGGACACCCTGACCGATCAGCTGATCGAGGCGCTG
AAGTCGGTCTATGACCCGGAAATCCCGGTCGACATCTATGAGCTGGGCCTGATCTACCGC
GTGGACGTCAACGATGACCGCGATGTGGTGGTGGACATGACGCTGACGGCGCCGGGCTGT
CCGGTCGCCGGCGAAATGCCGGGCTGGGTGGAGACGGCGGTGGAGAAGGTCGAGGGCGTG
CGCAGCGCCAAGGCCAATCTGGTGTTCGATCCGCCGTGGGACGCCTCCAAGATGAGCGAC
GAGGCCAAGCTGGCCCTGAACATGTTCTGA