METABLE2 Genes

PROKKA_00085 Brevundimonas

GenomeBrevundimonas ctg_1:92839-93186
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF04993.7
Sequence
>PROKKA_00085 hypothetical protein
ATGGCCTACGACCCCGACTTCGGCGAATGGGCGCGCGAGCATTTCCACGCGCGCGGCCGC
CTGGAGATCAAGCGCATGTTCGGCGGGGCAGGGATCTATGCCTCCGGCGTCATGTTCGCC
CTGCTGGACGACGGCGTGGTCTGGCTGAAGGGCGACGAGGCGCTGGGCGAGGCCTTCGTC
GATGCCGGTTCGCGTCAGTTCACCTATCCGACCAAGGACGGCCGCACGATAAGCATGGGC
TACTGGACCCTGCCCGAAGCGGCTCTGGACGATCCCGACGAGGCTGTCGCCTGGGCGCGG
CGGTCGCTGGATGTGGCGGTCAAGGAGGCGTCGGGAAAGAAGCGTTAG