METABLE2 Genes

PROKKA_00086 Brevundimonas

GenomeBrevundimonas ctg_1:93183-93383
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00086 hypothetical protein
ATGATAACGCCCCTTGCCTCACCACCCGCCGTCGAAACCCTGACGATCCAGCCCGTCGGC
GATCGCTGGCGCATCACCTCAAGCGACGGCCTGTTCGAAGGCGTCTTCACCGACGCCAAA
AGCGCCGTCCGATGCGCCAGAGCGGAGGCCGAGGCGCATCCAGGGCACTCGGTTCGGATG
GTTCGACCCGATACGGCCTAA