METABLE2 Genes

PROKKA_00087 Brevundimonas

GenomeBrevundimonas ctg_1:93380-93589
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00087 hypothetical protein
ATGATGCAGGGCCACATCGAGGGCGGCGTGACGCGCGCCGCCCCTCCCCGACGCTATCGG
GTCGTGCCTCGCGCCAGCGGTTGGGCCGTGGCGGTCAACAACGCCTGCACCCGCCCCCTG
CCTGATCGCATCTCGGCCGAACGCCTCGCCGCCCGACTTCAGGCCGAGGCCGACCGCCTG
AACCGCGACCAACATCGCCTCACACAATGA