METABLE2 Genes

PROKKA_00088 Brevundimonas

GenomeBrevundimonas ctg_1:93586-93714
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00088 hypothetical protein
ATGAGCCGTTCGCACCTGTTGGCCGAGACACTGAAACGTCCAGCCCCAGCGCCGACAACC
CTTCAGATGGCGATGACCTTCATCGGCGCCCTGTTCGGCACCCCGATCCGCAAGGGCCGC
GCGCGATGA