METABLE2 Genes

PROKKA_00002 SelectedGram+

GenomeSelectedGram+ ctg_1:1516-3303
ProductCDS recombination protein F
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK00064
Sequence
>PROKKA_00002 recombination protein F
ATGAGAGTAGCGATCTTGGATATCCAAAATTTTCGCGGTATCCGTGCAGGAAGCGTTCAC
TTTAAAGACCATCCTGTGCTGATCGGGGCTAACAATACCGGCAAAACTACGGTAATAGAG
GCATTGACGCTTCTTCTAGGAAGGGAGCGGATGATCAGGGAACTCACCGAACATGACTTT
TACGGTTCAGATCCCCAGCCTGCCGACCGAATAAAGCTTATAGCCACAATCACAGATTTT
CCTTCCGAAGACCCTTATCAGAATACCGATTGGTTTAGAGACGGCAGAGGCGTGCCTAAA
TGGCTGGACGAAGCCAACGGTACGATCAGCGCGGTTCGCACCGAGGAGGCATCGAAGCTT
TGCTGCCAAATCGGCGCTCAAGCTTATTTCGACCGCGACTCACTCTCGGTCGAGATGGTT
CGTTACTTCCACGATCACGATAGCCCGATGGATCCCTTCGCCGACGACTCGCCCGTTGGC
GTTCCTCCACGCTTGATAAAAGAGATTGGGTTTTATCTCGTACGAGCGAGCCGTACCTGG
GACAAGGTTTTTTCATGGGGCAGTGAGCTATTCCGGCGCACGCTGCAAGCAGCCGCAGCC
CAACCGTCCGAGGCGATTTTAGCTGAGCGCGATCGGCTCAGGCGCCCGGAAGCCCCCATC
GAGAACGATGATCGAATTTCACCACTGATACAGAACGTCAACGCTGAGTTAGCGAGATGC
ATACCGAACGCGCCACATGTTCAACTTCGGGTGACGAGCACTGATAGCCGATCGCTTCTT
GACTCTGTCGCTGCACATTTCGCTGTCGTCGGAGGTCTGGGCGTACCCGCCGCCAGACAG
GGCAGCGGCTTGGTTTCTCTGCAAGGTTTGTTACTACTATTGGAACTAGGTCGAGGACGT
GCAGCCGCAGGTGAAGGATTTCTAATGGCCTTGGAGGAGCCCGAGCTTCACCTGCCCCCA
GCAGGTCAGCAACAGCTGGTACAACGAGTGCAAGCACTCTCGACCCAAACCTTCATTACT
ACGCATTCCCCATTGATTGCTGCGGTATCAGATCCAACCTCTGTATTGATTCTCCGAAAT
GTCGACGGCCATCTCTCGGCCCTTCCTTTTTTATCAGAGCCCTTGCTACCAAATGCCCAG
AATTGGAAGAGGAAGTTTTTTCAGCAAAGTCGTGTGGACGTCCTGTCGGCTTTAATGCAC
CCGTGTGTATTGGTGCCTGAAGGCCGTGCTGATTTCTTGTTACTGAAAACGGTGCTACGA
CCCTTGATGTTGACCGAGGGTTGGTCCACGAGCATGCCATCTATGTTTGGACTGGAGGTC
GGCGTCGTTCCAACTGAGGACGCCAAGGTGGTAGAGACGTTCCAGTTACTGTCAGCCACT
CATCACAAGGTCTGCTGCCTGGTGGACGGCGACAGAGATGGTAAACGCTACATCACCAGC
CTTCTGGCAGAACCCACTGCTCCCTCATCAATAATACGGTGGGCTGACGACGAGATGATC
GAAGACGCCATCGGCTGGATTTTGGCTGCGGATGAAGTCGACGTTGTTGGGAGGCTTTCG
GAGTTGACGGAGGTTGCCCCCTCGACTGTGTCCGACATCGTCACCCACTTAAAAAATAAA
AAAGTGGACGTGATCTGCTACGAGTCGGTGGCAGACGCGATAGTTAACTCACCTCTCTGC
CGTGCCAGAGCAGCAGAGTTGTTCAGCTGTTTGGCTATGGCGTGCGCGGGAACTGCTAGT
GCACATTTCGTCGCCGACCCAGAGGGTGTCTGGGTATTCCAACCATGA