METABLE2 Genes

PROKKA_00005 SelectedGram+

GenomeSelectedGram+ ctg_1:5702-6832
ProductCDS Glycogen synthase
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:O53279
Sequence
>PROKKA_00005 Glycogen synthase
ATGCGCGTTCTTCATTTCTTCAAGACGTACCTGCCCGATTCGGTCGGCGGCATCGAACAA
GTCATCTTCCAGCTGTGCGAGAGCGGTGCCCAACACGGCATCGACGCGCAAGTGCTGACC
TTGAGCACAGACCCGACACCGCCCGTGGTGCAACTGGGTCAGCACGAAATACATCGGGCG
AAGCTGGATATCCAGTTCGCCTCGACCGGGTTTTCCTGGAGTGTGTTCAAGCAGTTCCGT
GAGCTGGCCGCCGAAGCCGACGTGATCAACTATCACTTCCCCTGGCCGTTCATGGACCTG
GTGCATTTCGCCAGCGCCATGAACAAGCCGAGCGTGGTCACCTATCACTCGGACATCATT
CGCCAAAAGCATCTGCTCAAGCTCTATCGGCCACTGATGAATCGCTTCCTCGCCAGCGCC
GACCGCATTGTTGCTGCATCGCCGAACTATCTGCACACCAGCGATGTGCTGCAGCAGTTT
CAGGACAAGACCCGCGTTATCCCCTACGGCCTGAATAAAGCAGGTTATCCACAGCCCGAT
ACCGAACGCATGAACCGCTGGCGCCAACAGCTTGGGGATAAGTTTTTTCTGTTCGTCGGG
GTGATGCGTTATTACAAGGGCCTGCACATCCTGCTCGACGCGCTCAAAGACATTGATTAT
CCCGTGGTGATTGTCGGTGCCGGTCCGCTGGAGCAGGAACTGCACGCACAGGCCGCCGCG
CTGGGCCTGCGCAATATTCACTTCCTCGGCCGTCTGAGCGACGAGGACAAAGTGGCGTTG
CTGCAATTGAGCTACGCGATTGTCTTTCCTTCGCACCTGCGCTCGGAGGCTTTCGGTATT
TCGTTGCTCGAAGGCGCGATGTACGGCAAACCGATGATCTCCAGCGAAATCGGCACCGGT
ACCAGTTTCATCAATATCCACAACGAAACCGGACTGGTGGTGCCGCCGAGCAATCCACAG
GCTTTTCGGGAAGCCATGCGTACGCTATGGGACAACCCTGAGCGTGCCGCCGAGATGGGG
ACCAAAGCCGAAGCGCGCTATCGGCAGTTGTTCACCGCCGATGAGATGGGTCGCAAGTGG
ACAGAGCTGTATCAGGAACTGCTGGCTGAAAAGGCTCTGTCCTACGCTTGA