METABLE2 Genes

PROKKA_00006 SelectedGram+

GenomeSelectedGram+ ctg_1:6833-7963
ProductCDS Glycogen synthase
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:O53279
Sequence
>PROKKA_00006 Glycogen synthase
ATGCGCATTGCCCTTAACGCCCGCATCCTGCAGGCGCCGCGCACCGGCATCGGCCACTAC
GTCGCCGAACTGGTCAACGCCTTGCGCAGCGAACCTGATGTGGACGTAAGCCTGTTTCAT
GGCTGGGGCTGGAGTTCGGCCCTGCCGGACGCGGCCATGCCCGGCTACTCGCGCATGACG
CCATTGCTGCGAAAAATTCCCGGGGCCTATCAGGCACGCCGCTGGCTGGAGCAGAAACGT
TTCGATCAGGGGCGTGCGCAAGGGCTCGATCTTTATCACGAGCCGAGCCTGTGGCCGCTG
GCCTTCGACGGTCCGACCGTGATCACCCTGCATGACCTGACGCACCTGCACTACCCTGAT
ACCCAGCCGCCGGCACGTCTGAGGGAGATCGAGCGTCGTCTGGCCGCCGGTATGGAGCAG
GCGCGGGTCATTCTGACCGATTCGCAGGCGATCGCTGACGAGGCGCAGGCCTACTTTAAT
CTCCCTGCGCAGCAATTCGTTGTGGCGCCGTTGGGTGTGTCCGAGCGCTTCCGTCCCCGG
CCACTTGAGGAAATCGACAGTGTGCTCAAGGCTCACGCCGTCCAGGCACGGGAATATTTC
CTCTGTGTCGGCACCCTCGAGCCGCGCAAGAACCTGAGCCTGGCGTTGCAGGCCCACGCC
CTGCTGCCAGACGCCGTGCGCCAGCGCTTTCCCTTGTTGATTGCAGGCATGGCCGGATGG
CAGCGCGAACAGTTCAACGAGCCACTGCGCCAGGCACTGGCCAGCGGCCACGTGTGCCTG
CTCGGCTATCTGCCCGATGAGCAATTGGCGCAACTGCTGGCCGGCGCCCGGGCGCTGATA
TTTCCGTCGTTGTATGAGGGCTTTGGCTTGCCGGTGCTGGAAGCCATGGCCAGTGGCACG
CCGGTGGTGACCACCCGTTCTTCGGCGATGCCGGAAGTGGCTGGCGCGGCTGGCAACTAT
ATTGAAGCGGACGATGCCGAGGGTCTGCGTGATGCAATGGGCCGGTTGATCGACGACTCG
CTGCATTGGCAGGCCTGCCGCGAAGCGGGATTGCAGCAGGCGGCACTTTTTTCCTGGCAA
CGTTGTGCACAGGCTACGGCTGGTGCCTACCGCCAGGCCATGGGAGGTTGA