METABLE2 Genes

PROKKA_00013 SelectedGram+

GenomeSelectedGram+ ctg_1:15109-16689
ProductCDS Glycosyl transferases group 1
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF00534.14
Sequence
>PROKKA_00013 Glycosyl transferases group 1
ATGAATTTCATTCTTTATTCGGACATCAACGAACACTCCATCAGGGAGAGTCTCGGCCAT
CCCGACGCCAGTTATTACTTCGTTCTGAAGGCCTACCGTTCGTTGCTCGAAACAGTCGGG
CGAGTCCATGTAGTGGGTAATGTCGCAGAGGTCGATCCGCTGTTTCGGCAATTCCATGCG
ACCGGCGAGGAGAGTGTGTTCCTCTCGTTCACCCGACCACAGAAAACGGCGATCGACCTC
CAATGCCCGACCGTTTGTGTCGTGACTTGGGAGTACGACTCGATTCCCGATGAACAATGG
GGCGATGATCCTGGCCAGGACTGGACGCGCATGTTGGCAAGGCATGGCCGCGTGATCACG
CTGTCCAGCCATACCGCCCGAGCGATTCGTCGCTCAATGGGAGAGGATTTCCCTGTGCTG
GTATTGCCCGCCCCACTCGGAGAGGAGCTTGCGTCCATCGGCAAGCAGCACCTCAGCACA
CCGGTCAACACAGGTACGACGTTGACGCTCAAAGGGTGCATTTTCGATTCCCGCCAGATG
AACCTGCATCCGGATAATCTGCTGCCCAAGCCTCTCACCGCCGAAGAACTGGCGGAAATC
GAAGCTCAGTTGGAGGCTTCGCGACCACCACCGCTGACGTGGAAACGACGCTTGGTCATC
GCAAAGCATTACCTGCGCCTTTGGCTGCTCAATGCCGGCCATGATCAGACGCCTGTGGTG
CCACGGGTGAGTTTTTTGCGGAATTGGTACTGGGAGGGGATTCACGACTTGCTTAGGCAT
TCCTGGCATGACTGGCTCGCCAGACATTTGCCCGGTATCGCCGGCCCTCAACCTTTGCCG
GTATCAGTGCAACCGCCACCGCAAGATATGCCGGACACCTCGTTACAGGTTCAAGCCGAG
GTCGACGGTGTGGTCTACGCGTCGGTGTTTCGCCCCGCGGACGGGCGCAAGAACTGGCTA
CAGATTCTCACCGCTTTCTGCGCGGCCTTTCGTGACACTCCAGACGCCACACTGGTGATG
AAATTTACCCAGAGCGACCTGGCGGCCGTCTATGCACACTTGATGACGCCACTGGCGCAA
CTGGCGCCTTTTTCCTGTCGGGTCGTGATGATTCACGGTTACATGGACGATGCGCAATAC
GCGCGGCTTTACCAGTCGGCGAGTTTTTACGTCAACGCCTCGCATTGTGAGGGTCTGTGT
CTGCCGCTGATGGAGTTCATGGCCTGCGGCAAACCGGTGATCGCCCCCGGCCACACGGCG
ATGCAGGACTATATCGACGAGTCTGTGGCGTTCGTGGTCGACTCCAGCGTTGAGGCGTGC
ACGTGGCCCCATGACCCGCGCATGCTGTTTCGTGCGCATCGTCACCGGCCAGACTGGGGC
TCCTTGAAACAAGCCTACGAAGACAGTTACCGGATGGCCACGACACAGCCTCAGGATTAT
CAGCGAATGTCTTTGGCTGCCGCGCAACGCATGGAGCATTTTAGTGCGATCGCGGTTCTG
CAAAAGCGCGTCGTGGATTTTTTCGGGCTCGAACCACAGCCCGGTCACGTTGCCCAGGTC
AGGGATAGCGCCCCATGCTGA