METABLE2 Genes

PROKKA_00014 SelectedGram+

GenomeSelectedGram+ ctg_1:16683-17987
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00014 hypothetical protein
ATGCTGATCATCATCCATTCGGAAACCAACCAGCACACCATCAGCCGCAACCTGGGGCGC
TCGGAGTACAGCTATTACTTCGTGCTCAAGGAGTATCGGCCAGTGCTCGAACGTCTGGGT
CGGGTGATCGAGGTCATGGACCCGAACAGCGAAGTCGATGCGTTGTATGCAGAGTGCCAG
TCACGTGGCGAGCCTTGCGTATTTCTGTCGTTCTCGCCACCGCATCGCACCCCGGTGCAT
TTGGCGTGTCCGACCTTGCCGGTCTTTGCCTGGGAGTTCAGCACGATTCCCGATGAGCCA
TTCGCTGGCGATCCGCTGAACGACTGGCGCACAGTACTTGCCGCCTGCGGTGCTGCGATC
ACGCACTCCAGTTACACGGTCGATGCCGTGCGCAAAGCGATGTCTGTCGAGTACCCGATA
GTCGCCGTCCCCGCGCCGGTCTGGGATCGGTTCGCAGCGCGCGGCGTTCAATTGCAGGAG
CAGCCGGCCATCGATTCAGTACGGCTGAAAATCAAAGGCCTGGTAGTCGACAGTCGCGAG
ATCGCCTTGGATGCTTTCGCTCCTGTGCCGTTGCGCCGTGGGCGTGGAATCGATTTCCTC
GCGCCGGTCACCGAGCAAGAGCTGGTGCTTGAAGGTGTGGTGTACACCTCGGTGTTCAAC
CCCCGGGACGGGCGCAAGAACTGGGAGGACATGATCAGCGCCTTCTGTGCCGCTATGCGG
GAAAACGCTGATGCAACCCTGGTGCTGAAACTCACCCATCACGATGCTGAAGAAGCCCTC
ACCGACATCCTCCATCACCTTTACAAGAATCAGCCTTATCGCTGCCGCATCGTGCTTATC
TACGGCTATCTGGCAGACGCGGATTACGAACGTCTGGTGCAGGCGACCCGTTACGTCGTC
AACACTTCCTACGGCGAAGGCCAGTGCCTGCCGCTGATGGAATTCATGTCGTGCGGCAAG
CCGGCTGTGGCACCGTGCACCACGGCAATGATCGACTATATGAATGCCGATAACGCTTTT
CTGATCGAGGCAACCGAGCAATTCACGGCCTGGCCTCACGACCCGCGTTCGGCCTACCGA
ACCTTGCGCTACGCAACGAGCTGGGCTTCGATCTGTGCCGCTTACACTGCCAGTTACGAC
GTCGCGCAAAATGATCCCCAGCGTTACGCCACCATGTCGGCACAGGCTGTCGTGAGTCTC
GAGGCGTTTTGCAGTCAAGCGGTGGCCGAGCAGCGATTACGGGCGTTTCTGGCGAGCCTG
CTGCAAGCCCGCGCCGAAATGGCGACGGAGGTTATCGGCGCATGA