METABLE2 Genes

PROKKA_00015 SelectedGram+

GenomeSelectedGram+ ctg_1:17984-18916
ProductCDS putative S-adenosylmethionine-dependent methyltransferase/MSMEI_2290
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:A0QUV5
Sequence
>PROKKA_00015 putative S-adenosylmethionine-dependent methyltransferase/MSMEI_2290
ATGATTCGCAGATTGCTTCATCGATTGTTTGCCCAAGCGCAATCTTCGCAATCGCCGCCA
GCGGCTGAACCGATAGCGGAACCGGTGATTGAGCCGACGCCAGACGCTGAACCCGAGCCT
TTATTTGTCTGGTCGCCCCGCGATGTCGGTTTGCGTGATGCCGTGCTGGACGGCTGGTTT
CTCAATGACAGCGGCGAATTGCTCAAGGGCTTTGCCATTAAGCCTGACGACACCGTGCTC
GACGTCGGTTGCGGCGAGGGTGCCGCAACATTGTTTGCCGTACGCCAGGGCGCATCGGTG
ATTTTCACCGACAGCGAATACGACAAAGTGCGCGAGCTGGCGCGTCAGGTCGAGGCGCAA
AGCGCAAATACCAGTCTTGGTCTGGTCAGCAACAGCCTGCCATTGCCGCTGGCCGACGGC
TGTGCCAGCAAAGTGGTGTGCATGGAAGTGCTGGAGCACGTCGACGAACCCGAAGCGTTC
ATGGCCGAACTGGCGCGTATGGGGCGCCCCGGTGCGTTGTACCTGCTCAGTGTGCCGGCT
CCAGTGGGCGAGCATCTGCAAAAAGGCATCGCTCCGCAGAGTTATTACCAGTCGCCCAAC
CACGTGCAGATCTTCACTCCAGAGCGCTTCGCCGCACTGGTCGAAGACGCCGGACTGATC
ATTGAACATCGGCAGGCGACGGGGTTTTTCTGGGTGATGGGGATGATCTTTTTCTGGGCC
AGCGAAAAAGCGGCCGGCAAGGATCCGGGTGGTGCGGTGCGTGATCGCATTCACGCGCCT
TTTCCTCATCTGATGGGTGGATGGGCGAGGACCTGGGAAGAGATGCTCGACCGGCCCGAC
GGACTTGCGATCAAACAGGTGCTGGACCAGTTCATGCCCAAAAGCCAGGTGATCATCGCC
CGTAAACCGCTGGATGCGGGAGACGACGGATGA