METABLE2 Genes

PROKKA_00017 SelectedGram+

GenomeSelectedGram+ ctg_1:20129-21313
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00017 hypothetical protein
ATGCGGTTGATTGTGTGTCTGTTCCTTGGCGTCTTGCTTGCGGGTTGCGAGCAACACGTC
GCGCCGGCCCTCGACCAGCAACTCTACGTCTGGCAGCGCCAATGGACGCCTGCGCATGAA
CCGGCCTTGCGTGACAGTCGCGATGATTTCTCGACGCTGCGCGTGCTGGCATTGCAGGCC
TTTCCCGGCGAACGGTGGAGCAGGGCGCGGGTTGATCCAGCCTTGTTGAGAGCCGATGGC
CGGCCGTTGATTGCAGTGATTCGCCTTGATGGTCAGCTGCAATCACTGGACCAGCAGCAG
GTCACCGCGCAGATTCGGCAAGTCATCGCCGATTGGCAGGCGCAGGGCCTCACGTTGAGC
GGCGTCGAGATCGATCACGACGCCGGTACAGCACGGCTGCCTGCGTATGCCCAATTGCTC
AAAGATCTGCGCGCGACCTTGCCGCCATCGTTGCCTTTGAGCATCACCGCACTGCCGGCC
TGGCTCGACAGCGCGCACTTGCCGGCGCTGTTGCAGAGCGTCGACAGCAGCGTGCTGCAA
GTCCACGCCGTGAGCGATCCGCGACTGGGTCTTTTCGACGCCAGGCAGGCGTTGAAGTGG
GCCAAGGCCTGGGCACATGTCAGCGACAAACCGTTCTATCTGGCGCTGCCGGCCTACGGC
GTTGCGCTGTTGAGCGATGATGGTGGCGCGCCGGTAGTGGAAAGCGAAGTGCAACTGGAG
CGCGGCGGGCAGCGCCGGGAATTGCTCGCCGATCCGCAGCAACTAAGCCAATTGGCCAAA
ACCTTGCGCGAGGATCCGCCTGAGCATCTGGCCGGGTTGATGTGGTTTCGCTTGCCGCTG
ACCAACGATCGTCGCGCCTGGAGCCTCACCACTTTGCGCGCCGTGGCGCGGGGCGATGGG
CTGAACACTCGGTTGGATCTGTCATTCAAAGAGCAGGATGGACTCTATGACATCCAGCTC
GAAAACCGCGGCAATCTCGACAGCCCGTGGCCCGCGAAAATTACCTTGAAGGCGCAGGAT
TGTGCAGGTGCCGATGCGCTCGCCGGTTACTCGTTGCAACAAAGTGCCAATCTGCTTACC
TTCACCCGCCTGCGTGACGGCCGCTTGCCGGCGGGCGGGCAGCGCGCTGTCGGTTGGGCG
CGTTGTGCACATATTGATCAAGGAGGTTCGCATGTTGACCCGTAA